cy3 labelit kit (Mirus Bio)
Mirus Bio is a verified supplier 
Mirus Bio manufactures this product 
96
Structured Review
Mirus Bio
cy3 labelit kit
Cy3 Labelit Kit, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 96/100, based on 1903 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cy3+kit/Label+IT+Nucleic+Acid+Labeling+Kit/pm42003491-71-6-9
Average 96 stars, based on 1903 article reviews
Cy3 Labelit Kit, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 96/100, based on 1903 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cy3+kit/Label+IT+Nucleic+Acid+Labeling+Kit/pm42003491-71-6-9
Average 96 stars, based on 1903 article reviews
cy3 labelit kit - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Labeling:Article Title: Improved DNA binding to a type IV minor pilin increases natural transformation Article Snippet: .. For DNA localization experiments, 100 μl of overnight cultures grown in M63CA + G were co-incubated with 25 μg/ml AF488-mal and 100 ng of fluorescently labeled DNA for 30 min. Fluorescent DNA Cy3 was made from an ∼7 kb Δ pilT :: spec PCR product that was fluorescently labeled as described previously [ ] using the Article Title: Stimulated Trafficking of RNAi to Parathyroid toward Its Angiogenetic Vessels for Suppressed Secretion of Parathyroid Hormone Article Snippet: Secondary hyperparathyroidism is driven by pathological overproduction of parathyroid hormone.. Surgery is invasive, drug therapy offers only transient control, and both carry substantial side effects.. Previous efforts to deliver siRNA to the parathyroid glands achieved only marginal efficacy because the constructs lacked a targeting ligand to overcome the organ’s limited vascular permeability and were rapidly cleared by renal filtration. Article Title: Silica-coated polyion complexes for enhanced pulmonary messenger RNA delivery with optimized silica layer stability. Article Snippet: .. Polymerase Chain Reaction:Article Title: Improved DNA binding to a type IV minor pilin increases natural transformation Article Snippet: .. For DNA localization experiments, 100 μl of overnight cultures grown in M63CA + G were co-incubated with 25 μg/ml AF488-mal and 100 ng of fluorescently labeled DNA for 30 min. Fluorescent DNA Cy3 was made from an ∼7 kb Δ pilT :: spec PCR product that was fluorescently labeled as described previously [ ] using the Article Title: Cell penetrating peptide-functionalized small interfering RNA nanoparticles knock down HER expression in breast cancer cells Article Snippet: Other reagents were sourced as follows: siRNA (Integrated DNA Technologies), sense sequences of siEGFP: 5′-GGCUACGUCCAGGAGCGCACC-3′, siHer3: 5′-ACCACGGUAUCUGGUCAUAAA-3′, siHer2: 5′-GGUGCU UGGAUCUGGCGCUUU-3′; primer sequences: ERBB2/HER2: forward: GGAAGTACACGATGCGGAGACT, reverse: ACCTTCCTCAGCTCCGTCTCTT; ERBB3/HER3: forward: CTATGAGGCGATACTTGGAACGG, reverse: GCACAGTTCCAAAGACACCCG; ACTB: forward: CACCATTGGCAATGAGCGGTTC, reverse: AGGTCTTTGCGGATGTCCACGT. .. RNA isolation: Aurum Total RNA Mini Kit (Bio-Rad), cDNA synthesis: iScript cDNA Synthesis Kit (Bio-Rad), polymerase chain reaction (PCR): Prime PCR supermix (Bio-Rad), Lipofectamine RNAiMax (Sigma), RNA quantification: QuantiFluor DNA quantification kit (Promega), Protamine sulfate from salmon Grade X (Sigma), Article Title: Cell penetrating peptide-functionalized small interfering RNA nanoparticles knock down HER expression in breast cancer cells. Article Snippet: Other reagents were sourced as follows: siRNA (Integrated DNA Technologies), sense sequences of siEGFP: 5′-GGCUACGUCCAGGAGCGCACC-3′, siHer3: 5′-ACCACGGUAUCUGGUCAUAAA-3′, siHer2: 5′-GGUGCU UGGAUCUGGCGCUUU-3′; primer sequences: ERBB2/HER2: forward: GGAAGTACACGATGCGGAGACT, reverse: ACCTTCCTCAGCTCCGTCTCTT; ERBB3/HER3: forward: CTATGAGGCGATACTTGGAACGG, reverse: GCACAGTTCCAAAGACACCCG; ACTB: forward: CACCATTGGCAATGAGCGGTTC, reverse: AGGTCTTTGCGGATGTCCACGT. .. RNA isolation: Aurum Total RNA Mini Kit (Bio-Rad), cDNA synthesis: iScript cDNA Synthesis Kit (Bio-Rad), polymerase chain reaction (PCR): Prime PCR supermix (Bio-Rad), Lipofectamine RNAiMax (Sigma), RNA quantification: QuantiFluor DNA quantification kit (Promega), Protamine sulfate from salmon Grade X (Sigma), Plasmid Preparation:Article Title: Peptide-assisted lipofection enables efficient non-viral delivery of large CRISPR/Cas9 constructs for genome editing applications. Article Snippet: As a cell cycle arrest inducer, aphidicolin was obtained from Merck. .. Control:Article Title: Peptide-assisted lipofection enables efficient non-viral delivery of large CRISPR/Cas9 constructs for genome editing applications. Article Snippet: As a cell cycle arrest inducer, aphidicolin was obtained from Merck. .. Fluorescence:Article Title: Peptide-assisted lipofection enables efficient non-viral delivery of large CRISPR/Cas9 constructs for genome editing applications. Article Snippet: As a cell cycle arrest inducer, aphidicolin was obtained from Merck. .. Isolation:Article Title: Cell penetrating peptide-functionalized small interfering RNA nanoparticles knock down HER expression in breast cancer cells Article Snippet: Other reagents were sourced as follows: siRNA (Integrated DNA Technologies), sense sequences of siEGFP: 5′-GGCUACGUCCAGGAGCGCACC-3′, siHer3: 5′-ACCACGGUAUCUGGUCAUAAA-3′, siHer2: 5′-GGUGCU UGGAUCUGGCGCUUU-3′; primer sequences: ERBB2/HER2: forward: GGAAGTACACGATGCGGAGACT, reverse: ACCTTCCTCAGCTCCGTCTCTT; ERBB3/HER3: forward: CTATGAGGCGATACTTGGAACGG, reverse: GCACAGTTCCAAAGACACCCG; ACTB: forward: CACCATTGGCAATGAGCGGTTC, reverse: AGGTCTTTGCGGATGTCCACGT. .. RNA isolation: Aurum Total RNA Mini Kit (Bio-Rad), cDNA synthesis: iScript cDNA Synthesis Kit (Bio-Rad), polymerase chain reaction (PCR): Prime PCR supermix (Bio-Rad), Lipofectamine RNAiMax (Sigma), RNA quantification: QuantiFluor DNA quantification kit (Promega), Protamine sulfate from salmon Grade X (Sigma), Article Title: Cell penetrating peptide-functionalized small interfering RNA nanoparticles knock down HER expression in breast cancer cells. Article Snippet: Other reagents were sourced as follows: siRNA (Integrated DNA Technologies), sense sequences of siEGFP: 5′-GGCUACGUCCAGGAGCGCACC-3′, siHer3: 5′-ACCACGGUAUCUGGUCAUAAA-3′, siHer2: 5′-GGUGCU UGGAUCUGGCGCUUU-3′; primer sequences: ERBB2/HER2: forward: GGAAGTACACGATGCGGAGACT, reverse: ACCTTCCTCAGCTCCGTCTCTT; ERBB3/HER3: forward: CTATGAGGCGATACTTGGAACGG, reverse: GCACAGTTCCAAAGACACCCG; ACTB: forward: CACCATTGGCAATGAGCGGTTC, reverse: AGGTCTTTGCGGATGTCCACGT. .. RNA isolation: Aurum Total RNA Mini Kit (Bio-Rad), cDNA synthesis: iScript cDNA Synthesis Kit (Bio-Rad), polymerase chain reaction (PCR): Prime PCR supermix (Bio-Rad), Lipofectamine RNAiMax (Sigma), RNA quantification: QuantiFluor DNA quantification kit (Promega), Protamine sulfate from salmon Grade X (Sigma), cDNA Synthesis:Article Title: Cell penetrating peptide-functionalized small interfering RNA nanoparticles knock down HER expression in breast cancer cells Article Snippet: Other reagents were sourced as follows: siRNA (Integrated DNA Technologies), sense sequences of siEGFP: 5′-GGCUACGUCCAGGAGCGCACC-3′, siHer3: 5′-ACCACGGUAUCUGGUCAUAAA-3′, siHer2: 5′-GGUGCU UGGAUCUGGCGCUUU-3′; primer sequences: ERBB2/HER2: forward: GGAAGTACACGATGCGGAGACT, reverse: ACCTTCCTCAGCTCCGTCTCTT; ERBB3/HER3: forward: CTATGAGGCGATACTTGGAACGG, reverse: GCACAGTTCCAAAGACACCCG; ACTB: forward: CACCATTGGCAATGAGCGGTTC, reverse: AGGTCTTTGCGGATGTCCACGT. .. RNA isolation: Aurum Total RNA Mini Kit (Bio-Rad), cDNA synthesis: iScript cDNA Synthesis Kit (Bio-Rad), polymerase chain reaction (PCR): Prime PCR supermix (Bio-Rad), Lipofectamine RNAiMax (Sigma), RNA quantification: QuantiFluor DNA quantification kit (Promega), Protamine sulfate from salmon Grade X (Sigma), Article Title: Cell penetrating peptide-functionalized small interfering RNA nanoparticles knock down HER expression in breast cancer cells. Article Snippet: Other reagents were sourced as follows: siRNA (Integrated DNA Technologies), sense sequences of siEGFP: 5′-GGCUACGUCCAGGAGCGCACC-3′, siHer3: 5′-ACCACGGUAUCUGGUCAUAAA-3′, siHer2: 5′-GGUGCU UGGAUCUGGCGCUUU-3′; primer sequences: ERBB2/HER2: forward: GGAAGTACACGATGCGGAGACT, reverse: ACCTTCCTCAGCTCCGTCTCTT; ERBB3/HER3: forward: CTATGAGGCGATACTTGGAACGG, reverse: GCACAGTTCCAAAGACACCCG; ACTB: forward: CACCATTGGCAATGAGCGGTTC, reverse: AGGTCTTTGCGGATGTCCACGT. .. RNA isolation: Aurum Total RNA Mini Kit (Bio-Rad), cDNA synthesis: iScript cDNA Synthesis Kit (Bio-Rad), polymerase chain reaction (PCR): Prime PCR supermix (Bio-Rad), Lipofectamine RNAiMax (Sigma), RNA quantification: QuantiFluor DNA quantification kit (Promega), Protamine sulfate from salmon Grade X (Sigma), |
